| | The involvement of promoter methylation and DNA methyltransferase-1 in the regulation of EpCAM expression in oral squamous cell carcinomaReceived 8 December 2007; received in revised form 5 March 2008; accepted 6 March 2008. published online 09 June 2008. Introduction  The epithelial cell adhesion molecule (EpCAM) is a 40 kDa epithelial transmembrane glycoprotein encoded by the GA733-2 gene located on the long arm of chromatin 4.1, 2 This molecule is a homophilic and Ca2+ independent adhesion molecule that appears to be overexpressed by the great majority of human epithelial malignancies.2, 3 However, the biologic function of EpCAM in tumors is variable. It has been proposed as an oncogenic signaling protein and was associated with development of malignancy in certain types of tumors.3, 4 In contrast, other studies suggested that EpCAM could have a tumor suppressor effect in some malignancies.5, 6, 7 Previously, the expression of EpCAM and its clinical significance in OSCC was studied.8, 9, 10 However, the results were not consistent. Given the somewhat controversial results of EpCAM function in tumors, the biologic function and clinical relevance of EpCAM in OSCC needs to be systematically studied. Furthermore, regulation of EpCAM expression in OSCC is still unknown. Recent evidence has suggested that EpCAM expression could be dynamic during tumor progression. For example, Rao et al. showed that EpCAM expression was relatively lower in circulating tumor cells compared to primary and metastatic tissues11 Jojovic et al. demonstrated EpCAM expression could be transiently lost during development of metastases.12 The expression of some genes can be dynamically regulated by reversible epigenetic events.13 Aberrant DNA methylation is one of the most common epigenetic mechanisms regulating gene expression in human cancers.14 However, information regarding methylation alterations of EpCAM in OSCC is not available. The methylation of mammalian genomic DNA is catalyzed by DNA methyltransferases (DNMTs), which play a special role in the regulation of chromatin remodeling and gene expression. The mammalian DNMTs are DNMT1, DNMT3A and DNMT3B, which together with accessory proteins such as DNMT3L are responsible for methylation pattern acquisition during gametogenesis, embryogenesis and somatic tissue development.15 DNMT1 is the most abundant DNMT targeted to replication foci and has a 10–40-fold preference for hemi-methylated DNA substrates.16 It seems to be the main enzyme responsible for copying the methylation pattern after each round of DNA replication.17 Recent observations suggest a complicated network of connections between DNMT1 and several cellular proteins that could mediate methylation-dependent and some non-methylation-dependent functions of DNMT1 as cells progress to malignancy. For example, it has been shown that DNMTs are overexpressed in tumorigenic cells18 and upregulation of DNMT1 in vivo occurs in several different tumor types.19, 20, 21, 22 However, its function in OSCC and involvement in EpCAM methylation is not clear. In the present study, we therefore undertook an investigation to determine the role of EpCAM and DNMT1 in OSCC and to study the possible involvement of DNA methylation in the regulation of EpCAM. We also investigated the correlations among EpCAM methylation, EpCAM and DNMT1 expression, and clinicopathologic parameters. Materials and methods  Patients and tissue specimens The specimens were obtained from the archives of Tri-Service General Hospital and included 112 samples of OSCC. Detailed information is as described previously.23 From each tissue block, a series of 5-μm sections were cut. A 5-μm flanking section was H and E section (hematoxylin and eosin)-stained for pathological evaluation to identify the tumor and normal regions. Another 5-μm section was used for microdissection. Series sections were used for immunohistochemistry (IHC). Genomic DNA isolation and bisulfite modification and methylation-specific PCR DNA isolation from microdissection cells was performed using the Wizard Genomic DNA Purification Kit (Promega). The bisulfite reaction was carried out using EZ DNA Methylation Kit (Zymo Research) o convert non-methylated cytosines (C) to uracils (U) and ultimately detected as thymidines (T) after PCR amplification. PCR was performed using specific primers in 25 μl of a mixture containing 2 μl PCR buffer, 1.0 μl of each primer, 2.0 μl of 2.5 mM dNTP, 1 μl of Taq polymerase, and 1 of template. The amplification was carried out for 35 cycles (30 s at 95 °C, 30 s at the annealing temperature, and 30 s at 72 °C), followed by a final 5 min extension at 72 °C. Targeting the CpG island spanning the EpCAM promoter, we used methylation-specific PCR (MSP) primers specific for methylated DNA (upstream, TTTAACGTCGTTATGGAGACGA; downstream, TTTAACGTCGTTATGGAGACGA) and unmethylated DNA (upstream, TTTAATGTTGTTATGGAGATGA; downstream, ACCACTAATACTCATTAATAAATCACCAC) to amplify bisulfite-modified DNA. Immunohistochemistry Specimens from the paraffin blocks were cut into 5-μm sections. Those sections were routinely stained with hematoxylin and eosin, and PAS, for histological diagnosis, and additional sequential sections selected for immunohistochemical studies. The antibodies used included anti-human EpCAM antibody (1:500) (Transduction Laboratory, Lexington, KY, USA) and anti-DNMT1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA). Immunodetection for EpCAM and DNMT1 was performed with a standard DAKO EnVision stain system (Dako Corp, Carpinteria, CA, USA). Sections were dewaxed and subjected to antigen heat retrieval. Endogenous peroxidase activity and nonspecific binding were blocked by incubation with 3% hydrogen peroxide and nonimmune serum, respectively. Slides were then incubated sequentially with primary antibodies for 16 h at 4 °C and DAKO labeled polymer (Dako) secondary antibody for 1 h followed by incubation with the peroxidase labeled polymer for 30 min. Diaminobenzidine hydrochloride (DAB) was used as the chromogen to visualize the peroxidase activity. Sections were counterstained with hematoxylin and coverslipped. Assessment of immunoreactivity Using a semiquantitative scale described previously,6, 24 the staining results of EpCAM and DNMT1 were classified into high and low expression according to percentage and intensity of staining results. Immunostaining results were evaluated by two investigators (YSS and LCC) without prior knowledge of the tumor’s histopathologic features and the patient’s clinical status. Statistical analysis Immunohistochemistry results in comparing number of sections of each histological type and clinical stage with each category of staining intensity were analyzed using the χ2 test for a table. Results  EpCAM protein expression Immunostaining of EpCAM was done in all 112 OSCC cases and in 43 normal tissues from the same patients. Normal and hyperkeratotic mucosal tissues showed negative to faint staining for EpCAM. A distinct margin of EpCAM staining was observed between normal and dysplastic epithelium (Fig. 1A). An obvious increase in staining was observed in most samples of dysplastic epithelium. In our series of OSCC cases, EpCAM staining was heterogeneous, with tumor cells demonstrating a diffuse pattern and an increase in membranous EpCAM staining in comparison with their normal paired control samples (Fig. 1B). In some tumors, EpCAM expression was heterogeneous in that staining was positive in some cells and negative in others (Fig. 1C). In some invasive tumors, we found losses of EpCAM expression in tumors disseminated within vessels or in metastatic lymph nodes (Fig. 1D–E). Lower EpCAM immunostaining was observed in 55/112 tumor samples (49%), in comparison with 57/112 (51%) tumor samples that exhibited higher EpCAM expression. Staining results, which indicates EpCAM expression, in relation clinicopathologic parameters were shown in Table 1. There were no significant correlations between EpCAM expression and clinicopathologic variables for OSCC tissues (Table 1). EpCAM methylation status in OSCC To determine whether DNA methylation is involved in EpCAM expression, we examined the methylation status of EpCAM promoter regions in these tumors. Tumor cells were isolated by microdissection, and DNA was extracted and modified using bisulfite. Then methylation-specific polymerase chain reaction (MSP) assays were done to determine the methylation status of EpCAM. Data on DNA extraction and bisulfite modification were available for 98 cases, which were further subjected to MSP analysis. Due to the quality and quantity of extracted DNA, a small portion of cases cannot be further examined. The missingness was random and unrelated to the value of any other clinicopathologic variables. Thus, a total of 72 samples were detected and analyzed. A representative result is shown in Fig. 2. Methylated alleles were present in 37 out of 72 samples (51%). Methylation status of the EpCAM promoter in relation to clinicopathologic features of OSCC patients is presented in Table 1. No significant correlations were found. We next determined whether methylation of the EpCAM promoter is associated with EpCAM gene expression. We analyzed the relationship between expression of EpCAM and promoter methylation in these 72 cases. In the 38 cases with high EpCAM expression, unmethylated and methylated promoters were detected in 24 and 14 cases, respectively. In the 34 cases with low EpCAM expression, unmethylated and methylated promoters were detected in 11 and 23 cases, respectively. There was a significant association between EpCAM methylation and low EpCAM expression in OSCC (Table 2, p = 0.008). Discussion  A large number of studies on EpCAM’s role in cancer have yielded variable results. Present study had examined (1) the relevance of EpCAM expression in the initiation and progression of OSCC and (2) possible epigenetic mechanisms of DNA methylation in the regulation of the EpCAM gene expression. Our study showed that increases in EpCAM expression could be involved in the initiation of OSCC. This was demonstrated by our finding of a significant increase in EpCAM expression in dysplastic epithelium and cancer tissues compared to normal epithelium. In agreement with previous reports that expression of EpCAM increases from baseline levels in normal oral epithelium to that of high levels in dysplasia and OSCC tissues,8 this observation further strengthened the hypothesis that de novo expression of EpCAM is an early event in tumorogenesis. Thus, EpCAM expression is an early step in the malignant transformation of oral epithelium, and could be used as a marker for diagnostic purposes. Although we did not find a significant association of EpCAM expression with clinicopathologic variables in OSCC, EpCAM expression seems to be flexibly regulated in cancer cells, which was demonstrated by its strong expression in primary tumors and weak or negative expression in disseminated tumor cells or lymph node metastases. In support of this notion, previous reports found that EpCAM expression in circulating and metastatic tumor cells is relatively lower compared to primary tumors from the same patient.11, 23, 24 These observations raise the possibility that in some subpopulations of tumor cells, loss of EpCAM is associated with malignancy and aggressive behavior. Actually, the expectation that EpCAM, like other adhesion molecules, provides invasion-suppressor properties to epithelia through cell-cell aggregation has been demonstrated. Normally non-adhesive cell lines have been induced to aggregate through transfection and overexpression of EpCAM and, in addition, have been shown to have reduced mobility and fewer invasive behaviors.25 Furthermore, negative or limited EpCAM expression in primary laryngeal carcinoma has been linked to the presence of nodal metastases and to a poor prognosis.26 Based on our findings and the functions proposed for EpCAM, we postulate that this adhesion molecule may play distinct and different roles at various stages in the evolution and progression of OSCC. These results may add new information for the application of EpCAM in diagnosis, prevention, and treatment of OSCC. That EpCAM expression is heterogeneous in primary tumors and transitional loss occurs in disseminated and lymph node metastases, suggests that regulation of EpCAM expression involves a reversible mechanism rather than irreversible genetic alterations. Cytosine methylation within the context of CpG dinucleotides in the genome is a molecular mechanism that causes epigenetic changes in chromatin structure and leads to transcriptional silencing of genes in many human cancers. This epigenetic alteration is heritable but does not alter the nucleotide sequence, making the modification potentially reversible. Previously, our work in lung cancer had shown that DNA methylation coupled with alterations in chromatin structure and transcription factor activity could be attributed to the reversible regulation of EpCAM.6 Spizzo et al. also found the promoter and exon 1 was highly methylated in an EpCAM negative breast cancer cell line compared to few methylated CpG sites in EpCAM positive cell lines, which implicated that methylation of EpCAM is, in part, responsible for EpCAM expression in some cancer cells.27 In the present study, our results show that promoter methylation is significantly correlated with the expression of EpCAM in OSCC, in which a high proportion of methylated alleles are detected in low EpCAM expressing tumors. These findings therefore suggest that an epigenetic mechanism via methylation of the EpCAM promoter might be responsible for dynamic regulation of this gene in OSCC. Although the importance of CpG island methylation in cancer is now becoming apparent, the mechanisms that lead to this phenomenon in tumors are still unknown. The most widely investigated potential cause is the increased expression in tumors of one or more of the DNMT enzymes. DNMT1 was the first enzyme to be isolated as a mammalian DNA methyltransferase.28 Hyperactivation of DNMTs in parallel with aberrant patterns of DNA methylation was reported in many tumor types.22, 29 However, in other studies investigating CpG island methylation status failed to confirm this relationship.30, 31, 32, 33 Here, we investigated the association of DNMT1 expression and promoter methylation status of EpCAM. Nonetheless, the expression level of DNMT1 did not correlate with the methylation status of the EpCAM gene in OSCC. This could be explained in part by the fact that aberrant promoter hypermethylation is caused by gene-specific regulation involving DNMTs and its interaction proteins. Actually, DNMT1 can interact with a number of different proteins that could be involved in the intracellular delivery and regulation of the catalytic activity of DNMT134, 35, 36, 37 as well as access to its DNA target sites in chromatin.17, 38 Thus, DNMT1 overexpression alone may not explain gene-specific DNA hypermethylation in cancers. Certain unknown components of the DNA methylation machinery may potently target DNMT1 to gene-specific methylation in OSCC. We showed that the expression of nuclear DNMT1 immunoreactivity correlates significantly with histologic differentiation and tumor malignancy in OSCC. Protein interactions with DNMT1 not only regulated its methylation-dependent but were also involved in methylation-independent function.32 For example, inhibition of DNMT activity in the human lung cancer cell line A549 by a DNMT antagonist or by antisense oligonucleotides induces a rapid upregulation of cyclin-dependent kinase inhibitor p21, which does not involve the demethylation of the p21 promoter. These results suggest that the DNMT1 protein might have a direct and immediate effect on the state of cell growth and transformation. Taken together, our results indicated DNMT1 expression may involve in the histogenesis and aggressiveness of OSCC and protein expression analysis of DNMT1 may be a biologic marker of tumor progression for OSCC patients. In conclusion, we demonstrated that promoter methylation is a major event involved in the loss of EpCAM expression in OSCC. Our study also indicated that upregulation of DNMT1 is involved in the progression of OSCC. Although expression of DNMT1 is elevated, additional mechanisms may be required for specifying specific cystosine residues for methylation and that other factors are therefore involved in gene silencing of EpCAM. Further studies on the cooperation between DNMT1 and other components of the DNA methylation machinery in tissue specimens may extend our understanding of the basis of regional DNA methylation during OSCC carcinogenesis. Conflict of interest statement  None declared. Acknowledgements  This work was supported by grants from the NSC-96-2314-B-016-044, NHRI-EX96-9602BC and TSGH-C95-24, Taiwan. We express our gratitude to Ms. Hsu-Hua Chu for her help in data analysis. References  1. 1Armstrong A, Eck SL. EpCAM: a new therapeutic target for an old cancer antigen. Cancer Biol Ther. 2003;2(4):320–326. MEDLINE 2. 2Winter MJ, et al. The epithelial cell adhesion molecule (Ep-CAM) as a morphoregulatory molecule is a tool in surgical pathology. Am J Pathol. 2003;163:2139–2148. MEDLINE 3. 3Went PT, et al. Frequent EpCam protein expression in human carcinomas. Hum Pathol. 2004;35:122–128. Abstract | Full Text |
Full-Text PDF (338 KB)
|
CrossRef
4. 4Brunner A, et al. EpCAM is predominantly expressed in high grade and advanced stage urothelial carcinomas of the bladder. J Clin Pathol. 2008;61:307–310.
CrossRef
5. 5Seligson DB, et al. Epithelial cell adhesion molecule (KSA) expression: pathobiology and its role as an independent predictor of survival in renal cell carcinoma. Clin Cancer Res. 2004;10:2659–2669. MEDLINE |
CrossRef
6. 6Tai KY, et al. DNA methylation and histone modification regulate silencing of epithelial cell adhesion molecule for tumor invasion and progression. Oncogene. 2007;26:3989–3997. MEDLINE |
CrossRef
7. 7Songun I, et al. Loss of Ep-CAM (CO17-1A) expression predicts survival in patients with gastric cancer. Br J Cancer. 2005;92:1767–1772. MEDLINE |
CrossRef
8. 8High AS, Robinson PA, Klein CE. Increased expression of a 38kd cell-surface glycoprotein MH99 (KS 1/4) in oral mucosal dysplasias. J Oral Pathol Med. 1996;25:10–13. MEDLINE |
CrossRef
9. 9Laimer K, et al. EpCAM expression in squamous cell carcinoma of the oral cavity: Frequency and relationship to clinicopathologic features. Oral Oncol. 2007;44:72–77. Abstract | Full Text |
Full-Text PDF (566 KB)
|
CrossRef
10. 10Yanamoto S, et al. Clinicopathologic significance of EpCAM expression in squamous cell carcinoma of the tongue and its possibility as a potential target for tongue cancer gene therapy. Oral Oncol. 2007;43:869–877. Abstract | Full Text |
Full-Text PDF (980 KB)
|
CrossRef
11. 11Rao CG, et al. Expression of epithelial cell adhesion molecule in carcinoma cells present in blood and primary and metastatic tumors. Int J Oncol. 2005;27:49–57. MEDLINE 12. 12Jojovic M, et al. Epithelial glycoprotein-2 expression is subject to regulatory processes in epithelial-mesenchymal transitions during metastases: an investigation of human cancers transplanted into severe combined immunodeficient mice. Histochem J. 1998;30:723–729. MEDLINE |
CrossRef
13. 13Esteller M, Herman JG. Cancer as an epigenetic disease: DNA methylation and chromatin alterations in human tumours. J Pathol. 2002;196:1–7. MEDLINE |
CrossRef
14. 14Jones PA, Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 2002;3:415–428. MEDLINE 15. 15Turek-Plewa J, Jagodzinski PP. The role of mammalian DNA methyltransferases in the regulation of gene expression. Cell Mol Biol Lett. 2005;10:631–647. MEDLINE 16. 16Gaudet F, et al. Induction of tumors in mice by genomic hypomethylation. Science. 2003;300:489–492.
CrossRef
17. 17Robertson KD. DNA methylation, methyltransferases, and cancer. Oncogene. 2001;20:3139–3155. MEDLINE |
CrossRef
18. 18Kautiainen TL, Jones PA. DNA methyltransferase levels in tumorigenic and nontumorigenic cells in culture. J Biol Chem. 1986;261:1594–1598. MEDLINE 19. 19Saito Y, et al. Increased protein expression of DNA methyltransferase (DNMT) 1 is significantly correlated with the malignant potential and poor prognosis of human hepatocellular carcinomas. Int J Cancer. 2003;105:527–532. MEDLINE |
CrossRef
20. 20Hammons GJ, et al. Increased expression of hepatic DNA methyltransferase in smokers. Cell Biol Toxicol. 1999;15:389–394. MEDLINE |
CrossRef
21. 21Sun L, et al. Increased DNA methyltransferase expression is associated with an early stage of human hepatocarcinogenesis. Jpn J Cancer Res. 1997;88:1165–1170. MEDLINE 22. 22De Marzo AM, et al. Abnormal regulation of DNA methyltransferase expression during colorectal carcinogenesis. Cancer Res. 1999;59:3855–3860. MEDLINE 23. 23Liu SY, et al. Clinicopathologic significance of tumor cell-lined vessel and microenvironment in oral squamous cell carcinoma. Oral Oncol. 2007;44:277–285. Abstract | Full Text |
Full-Text PDF (1258 KB)
|
CrossRef
24. 24Shieh YS, et al. DNA methyltransferase 1 expression and promoter methylation of E-cadherin in mucoepidermoid carcinoma. Cancer. 2005;104:1013–1021. 25. 25Litvinov SV, et al. Ep-CAM: a human epithelial antigen is a homophilic cell–cell adhesion molecule. J Cell Biol. 1994;125:437–446. MEDLINE |
CrossRef
26. 26Takes RP, et al. Markers for assessment of nodal metastasis in laryngeal carcinoma. Arch Otolaryngol Head Neck Surg. 1997;123:412–419. MEDLINE 27. 27Spizzo G, Gastl G, Obrist P, Fong D, Haun M, Grunewald K, et al. Methylation status of the Ep-CAM promoter region in human breast cancer cell lines and breast cancer tissue. Cancer Lett. 2007;246:253–261. Abstract | Full Text |
Full-Text PDF (294 KB)
|
CrossRef
28. 28Bestor T, et al. Cloning and sequencing of a cDNA encoding DNA methyltransferase of mouse cells. The carboxyl-terminal domain of the mammalian enzymes is related to bacterial restriction methyltransferases. J Mol Biol. 1988;203:971–983. MEDLINE |
CrossRef
29. 29Etoh T, et al. Increased DNA methyltransferase 1 (DNMT1) protein expression correlates significantly with poorer tumor differentiation and frequent DNA hypermethylation of multiple CpG islands in gastric cancers. Am J Pathol. 2004;164:689–699. MEDLINE 30. 30Eads CA, et al. CpG island hypermethylation in human colorectal tumors is not associated with DNA methyltransferase overexpression. Cancer Res. 1999;59:2302–2306. MEDLINE 31. 31Saito Y, et al. Expression of mRNA for DNA methyltransferases and methyl-CpG-binding proteins and DNA methylation status on CpG islands and pericentromeric satellite regions during human hepatocarcinogenesis. Hepatology. 2001;33:561–568. MEDLINE |
CrossRef
32. 32Sato M, et al. The expression of DNA methyltransferases and methyl-CpG-binding proteins is not associated with the methylation status of p14(ARF), p16(INK4a) and RASSF1A in human lung cancer cell lines. Oncogene. 2002;21:4822–4829. MEDLINE |
CrossRef
33. 33Doki Y, et al. Correlation between E-cadherin expression and invasiveness in vitro in a human esophageal cancer cell line. Cancer Res. 1993;53:3421–3426. MEDLINE 34. 34Hermann A, Gowher H, Jeltsch A. Biochemistry and biology of mammalian DNA methyltransferases. Cell Mol Life Sci. 2004;61:2571–2587.
CrossRef
35. 35Ji W, et al. DNA demethylation and pericentromeric rearrangements of chromosome 1. Mutat Res. 1997;379:33–41. MEDLINE |
CrossRef
36. 36Chuang LS. Human DNA-(cytosine-5) methyltransferase-PCNA complex as a target for p21WAF1. Science. 1997;277:1996–2000. MEDLINE |
CrossRef
37. 37Fuks F, et al. DNA methyltransferase Dnmt1 associates with histone deacetylase activity. Nat Genet. 2000;24:88–91. MEDLINE |
CrossRef
38. 38Baylin SB, et al. Aberrant patterns of DNA methylation, chromatin formation and gene expression in cancer. Hum Mol Genet. 2001;10:687–692. MEDLINE |
CrossRef
a Institute of Cancer Research, National Health Research Institutes, Miaoli 350, Taiwan b Department of Oral Diagnosis and Pathology, Tri-Service General Hospital, No. 325, Section 2, Cheng-Kung Road, Neihu 114, Taipei, Taiwan c Department of Internal Medicine, Tri-Service General Hospital, No. 325, Section 2, Cheng-Kung Road, Neihu 114, Taipei, Taiwan d School of Dentistry, National Defense Medical Center, P.O. Box 90048-503, Taipei, Taiwan Corresponding author. Address: School of Dentistry, National Defense Medical Center, P.O. Box 90048-503, Taipei, Taiwan. Tel.: +886 2 87923148; fax: +886 2 87919276.
PII: S1368-8375(08)00086-9 doi:10.1016/j.oraloncology.2008.03.003 © 2008 Elsevier Ltd. All rights reserved. | |
|